STEMCELL Technologies @STEMCELLTech
Committed to advancing life science research with innovative reagents, tools, and services. For product and technical support, email [email protected]. stemcell.com Vancouver, British Columbia Joined March 2009-
Tweets12K
-
Followers25K
-
Following6K
-
Likes14K
Follow this road map to increase the visibility and impact of your research. Print it out, put it up in your lab, or share it with a friend! bit.ly/4vhI2eo
Science burnout isn’t a lack of resilience—it’s a culture problem. In this episode of Lab Coats & Life™, we unpack the cost of always giving 200%, short-term vs. long-term output, and how lab culture shapes well-being. Listen wherever you get your podcasts!
Which one are you? stemcell.com/cellfatequiz?u… More below ⬇️
Start scaling mesenchymal stromal cell (MSC) and extracellular vesicle (EV) production with greater consistency and control. Join Dr. Marta Costa (iBET) to learn practical strategies for optimizing bioreactor workflows, improving EV isolation, and using real-time monitoring to enhance manufacturing quality and yield for cell therapy applications. Save your spot here: bit.ly/4dNovey
Check out our new, free on-demand course: Application of HSPCs in Cell Therapy. Whether you're already using CD34+ cells in translational workflows or just getting started, this course will help move your research closer to the clinic. Register now: bit.ly/4umEFCQ
Are these green flag behaviors part of your cell banking routine? ✅ Whether you’re new to hPSCs or have years of experience, following cell banking best practices can help protect against variability, contamination, and unexpected setbacks while supporting reproducible results. Here are some simple ways to build a more reliable, well-characterized cell bank from the start. Visit bit.ly/4wtMfNy to learn more.
Should scientists connect more directly with policymakers? 🏛️ The latest Lab Coats & Life™ Podcast explores how researchers can engage in policy, communicate clearly, and bring a human perspective to real-world decisions. 🎧 Listen wherever you get your podcasts.
POV: the dress code is strict… but you still make it fashion. 😎 Safety? Always. Style? Non-negotiable. #styleinspo #LabLife #STEMHumor #ScientistStyle #ootd #LabAesthetic
The #StemCellfie contest is returning in June 2026! It’s time to put on your lab coat, clean your lenses, and prepare to dazzle the microscopy world with your best cell image. 🪩 Look out for the official start date on our social channels over the next few weeks. In the meantime, admire some of our top 20 winners from 2025. 🤩 bit.ly/4wz0TmQ
Are you part of a life science journal club? 📝 Enter our contest for a chance to win a US$350 gift card (or equivalent) for your lab to spend on refreshments. bit.ly/4eutUta
Thank you to everyone who visited our booth or attended our Global Showcases! We enjoyed introducing our new Highway1™ Cell Sorter and GMP hematopoietic and immune cell media. #ISCT2026 may be over, but we’re still here to support you with reliable reagents for revolutionary therapies. 🤩 🔬 Explore resources for your #CellTherapy research: bit.ly/4sclf1E
Scientific societies are about more than just annual meetings - they’re the backbone of research advocacy and mentorship. New episode of Lab Coats & Life featuring Drs. Tenneille Ludwig and Rita Carsetti is out now! 🎧 Listen wherever you get your podcasts!
Join us today at #ISCT2026 to see how Highway1™ is helping streamline cell therapy workflows from bench to clinic! Global Showcase Presentation by Scott Tasker: Accelerating Cell Therapy: High-Speed, Closed-System Cell Sorting from Development to Manufacturing 📍Thursday, May 7 | 12:45 - 1:00 p.m. 📍Theatre A, Forum Floor (Ground Level) Want to see the Highway1™ in action? Stop by booth #1110 for a live demo during these windows: 🗓️ Thursday: 1:00 - 2:00 p.m. 🗓️ Friday: 12:00 - 1:00 p.m.
Poster and pitch 🎤 Our collaborator, Dr. Ho Quan Yao, will be presenting new work at #ISCT2026! 🧪 Topic: Vortex-Actuated Cell Sorting Boosts Expansion of CRISPR-Edited Human Regulatory T Cells This talk will highlight how gentle, closed-system sorting can support expansion of sensitive, gene-edited cell populations. 📍Join Dr. Ho Quan Yao this Friday, May 8 (8:00 - 9:00 a.m.) at the Immunotherapy Elevator Pitch Sessions. 📑 Abstract 1172
If you're at #ISCT2026 and working on translating cell therapies to the clinic, add this talk to your schedule. Global Showcase Presentation by Nooshin Tabatabaei-Zavareh, PhD: Next-Generation GMP Reagents for Hematopoietic and Immune Cell Therapy Manufacturing Learn how serum-free media and targeted differentiation strategies can support: • Reproducible HSPC expansion • Controlled lineage commitment • Flexible integration across workflows Wednesday, May 6 | 7:00 - 7:15 p.m. Theatre A, Forum Floor (Ground Level)
GIVEAWAY! Win one of three pairs of our science socks.🧦 STEMCELL Science News delivers the latest research in immunology, cancer, and stem cell biology straight to your inbox. Subscribe to any of the newsletters by June 30 for a chance to win: bit.ly/3Q8FRKY
CGTACTGAGGAGGACAGCTACCTCACTAGCTACACTGAC In other words, Happy #DNADay! 🧬 earthsciweb.org/js/bio/dna-wri…
It's hard to believe that #AAI2026 is already over! 🥺 We're delighted to have seen so many of you at our workshops, poster sessions, and booths. Revisit the highlights from #IMMUNOLOGY2026 and prepare for #AAI2027: bit.ly/4v4eQs5 @ImmunologyAAI
Organoid News @organoidscience
14K Followers 2K Following An online resource for researchers studying and using organoids. Part of the @STEMCELLTech Science News service.
Sergiu P. Pasca @Sergiu_P_Pasca
14K Followers 2K Following Kenneth T. Norris Prof of Psychiatry @Stanford; Uytengsu Director of @BrOrganogenesis; Physician-Scientist; Seeking to understand human brain assembly & disease
Cell Stem Cell @CellStemCell
59K Followers 69 Following A monthly journal at the forefront of stem cell science and policy. Posts & opinions from Editor-in-Chief, Dr. Sheila Chari
Hao Yin @HaoYin20
13K Followers 12K Following Cardiovascular biologist @WesternU PhD @UCalgary BSc @PKU1898 Views are my own Developmental Biology Social media editor @Dev_Bio_Journal Just call me Hao (How)
Miki Ebisuya @EbisuyaMiki
9K Followers 782 Following Synthetic developmental biologist at PoL TU Dresden. Cross-species comparison and manipulation of organoid zoo.
Madeline Lancaster @mad_lancaster
11K Followers 406 Following Developmental neurobiologist using cerebral #organoids to study brain size and evolution. Opinions my own.
Alejo Rodriguez-Frati... @AlejoFraticelli
12K Followers 7K Following Quantitative analysis of aging/cancer heterogeneity - @fraticellilab @icreacommunity @IRBbarcelona @ERC_research @criscancer @CaixaResearch 🇦🇷🇪🇺🇺🇸
Jeffrey Millman @JeffreyRMillman
7K Followers 2K Following Washington University School of Medicine Professor | Diabetes Researcher | Stem Cell Biologist | Bioengineer | Inventor | STEM Educator | Former MIT & Harvard
Mike Schumacher @schumacherama
2K Followers 507 Following Gut physiologist live-tweeting data on epithelial-immune dysfunction in the GI tract #organoids #ibd 🐾🍰✨🦋 https://t.co/DM7WGrgQki
Vijay Sankaran @bloodgenes
12K Followers 3K Following Pediatric Hematologist/Oncologist, Geneticist, Stem Cell Biologist - @HHMINEWS, @BostonChildrens, @DanaFarber, @broadinstitute
Stem Cell Network @StemCellNetwork
22K Followers 780 Following SCN is a Canadian not-for-profit supporting stem cell and regenerative medicine research, training, and knowledge mobilization.
Extracellular Matrix ... @ExtracellMatrix
5K Followers 790 Following An online resource for the extracellular matrix and tissue engineering research community. Part of the @STEMCELLTech Science News service.
Stem Cell Podcast @stemcellpodcast
9K Followers 2K Following Join us as we discuss the latest stem cell research, policy, and news with field experts. Brought to you by @STEMCELLTech.
Stem Cell Directory @Stem_Cell_Dir
13K Followers 4K Following Stem Cell Directory is a fully searchable, human-edited directory for the entire Stem Cell industry
ESC & iPSC News @ESC_iPSC_News
8K Followers 780 Following An online resource for the pluripotent stem cell research community. Part of the @STEMCELLTech Science News service.
Lund Stem Cell Center @Lund_Stem
3K Followers 4K Following A world-leading center for #stemcell #research @LundUniversity in Sweden now on BlueSky, follow us there: https://t.co/yosdMTwIk9
Mesenchymal Cell News @MesenchymalCell
6K Followers 453 Following An online resource for the mesenchymal stem cell and regenerative medicine research community. Part of the @STEMCELLTech Science News service.
Hematopoiesis News @Hema_News
3K Followers 556 Following An online resource for researchers studying hematopoiesis, blood, and bone marrow disorders. Part of the @STEMCELLTech Science News service.
Stem Cell Foundation @AusStemCell
15K Followers 325 Following National Stem Cell Foundation of Australia, founded from the Australian Stem Cell Centre. Promoting the study and use of stem cells and supporting patients.
Dr. Jan Nolta @jan_nolta
12K Followers 8K Following Director, University of California Davis Health Cell and Gene Therapy Center. https://t.co/eRW1uoT7g6
Cansu @mulksuzcansu
9 Followers 206 Following
Megu @mse_091828
4 Followers 112 Following
Pancho @Pancho793733919
54 Followers 970 Following
Bienve @BienveAF
2 Followers 132 Following
Anna Kim @AnnaKim_1
0 Followers 34 Following Process Development @BlueRocktx Prev R&D @STEMCELLtech Biotechnology @UofT
CRISTINA DE CASTRO G @cristinadecast5
448 Followers 683 Following Alergóloga, Captador SEAIC Córdoba. CM Adeslas, Hospital San Juan de Dios.
Nidhi Kotecha @nht2030
1 Followers 27 Following
Lled @dbsngdjdbdk
14 Followers 2K Following
Desheng Kong,MD @desheng_kong
854 Followers 4K Following Neurosurgeon,Peking University International Hospital.
Jun Li @simplelifeca
1 Followers 20 Following
Abdulmalik / عبدا... @Abdulmalik_h92
5 Followers 103 Following طبيب أطفال و أمراض دم و أورام / pediatrics and hematology , oncology investor / مستثمر
Wolfpack Army @WolfpackAgent
68 Followers 533 Following 🖱️ Put your money where your mouse is 🏆 Bet on yourself. Win big.
Hehehshshhhs @hehehshshh37953
0 Followers 48 Following
Sisu @MawawaPaul
192 Followers 1K Following Economiste et chercheurs en stratégie, citoyen du monde libre, chefs d'entreprise et politologue.
Money Mike @moneymiketrade
151 Followers 491 Following Collecting and analyzing data. *not financial advice
Huazhong University o... @2024_HUST
1K Followers 815 Following Official page of Huazhong University of Science and Technology (HUST) shows exciting news, research progress & campus life
Tony Larsson @TonyLarssonGoth
60 Followers 1K Following
anonymous @frededa96
1 Followers 35 Following
amdx @amdx_ai
56 Followers 707 Following A hub for interests in Blockchain Technology, Artificial Intelligence (AI), Web 3, and Technology.
Nina Ledwinka @VaidikaAvaidika
9K Followers 2K Following
Susana Koskinen @SakiIckes
525 Followers 3K Following 'The Last Republican in the state' Half Rev War Daughter, half Crazy Finn. Talk to the God (good) in people.
Clive Gao @GaoCliveClive
0 Followers 2 Following
Joy Oyovwevotu @KennyG007
308 Followers 4K Following A keen learner who believes that everyday is a new beginning. I am always grateful for the gifts of love and life.
YoungKwang Glory @Youngkwang_G
604 Followers 2K Following
Espelands 🇳🇴 2 ... @Johnny_Espeland
1K Followers 413 Following 1m+ catches | 2B+ XP | 49k Raids | 30k KM | 100m XP in less than a week| 32,6m XP in 24H |66,2k catches in a month | Mystic | Telegram⬇️
Joy Harris @JoyHarris511035
150 Followers 1K Following Make America great again, make our jobs stable again! I love you, Mr. President!
Yasir Babadidi @YasirBdd
31 Followers 219 Following Interested in a lot of things. Innovating africa-centric sustainable cutting-edge solutions. Anything that involves messing around with genes? Count me in!
girl @7im7bb
162 Followers 1K Following { رَبِّ اغْفِرْ لِي وَ لِوَالِدَيَّ } medical & Lab scientists |neuroscience & genetics Research-driven mind | Curious by nature, From cells to space ✨
Juha Lahtela @LahtelaJuha
79 Followers 281 Following
M&M @mmartinez0064
4K Followers 5K Following 'Las cosas podían haber sucedido de cualquier otra manera y,sin embargo,sucedieron así...// 🗨️ Reality Bites Block insultos
Bipin Makvana @bipin_makvana
16 Followers 61 Following
د. احمد الشق... @DrAlshoqafi
5 Followers 139 Following
Jose @jrivera_67
39 Followers 1K Following
biruk-1 3 1 3 @Biruk1313
2 Followers 134 Following
Bat Pitt 🦇 @ManniloTrader
369 Followers 634 Following 🦇 https://t.co/cQZk9NzQXa https://t.co/q7WMGJhlVt 💙😇🙏
Ladarius Sanders @LadariusSa62434
145 Followers 2K Following
cemil baış @bariscemil41
30 Followers 45 Following
Andrew Lake @AndrewL23015536
3 Followers 96 Following
Meenal Datta @DattaScientist
555 Followers 1K Following Assistant Prof @NDBioeng @AeroMechND @NotreDame; PI @NDTIMELab; cancer (re)engineering, tumor microenvironment, immunomechanics, mechanoimmunology, microgravity
Stemcells @Stemcells2026
0 Followers 11 Following We are pleased to announce the 3rd International Conference on Stem Cells, Regenerative Medicine & Tissue Engineering, April 19–20, 2027, in Milan, Italy.
Sergiu P. Pasca @Sergiu_P_Pasca
14K Followers 2K Following Kenneth T. Norris Prof of Psychiatry @Stanford; Uytengsu Director of @BrOrganogenesis; Physician-Scientist; Seeking to understand human brain assembly & disease
Cell Stem Cell @CellStemCell
59K Followers 69 Following A monthly journal at the forefront of stem cell science and policy. Posts & opinions from Editor-in-Chief, Dr. Sheila Chari
Hao Yin @HaoYin20
13K Followers 12K Following Cardiovascular biologist @WesternU PhD @UCalgary BSc @PKU1898 Views are my own Developmental Biology Social media editor @Dev_Bio_Journal Just call me Hao (How)
Miki Ebisuya @EbisuyaMiki
9K Followers 782 Following Synthetic developmental biologist at PoL TU Dresden. Cross-species comparison and manipulation of organoid zoo.
Madeline Lancaster @mad_lancaster
11K Followers 406 Following Developmental neurobiologist using cerebral #organoids to study brain size and evolution. Opinions my own.
Alejo Rodriguez-Frati... @AlejoFraticelli
12K Followers 7K Following Quantitative analysis of aging/cancer heterogeneity - @fraticellilab @icreacommunity @IRBbarcelona @ERC_research @criscancer @CaixaResearch 🇦🇷🇪🇺🇺🇸
Jeffrey Millman @JeffreyRMillman
7K Followers 2K Following Washington University School of Medicine Professor | Diabetes Researcher | Stem Cell Biologist | Bioengineer | Inventor | STEM Educator | Former MIT & Harvard
Jennifer Trowbridge @TrowbridgeLab
6K Followers 3K Following Professor & Dattels Family Chair at The Jackson Laboratory @jacksonlab studying hematopoietic stem cell biology, aging & cancer. 🇨🇦🇺🇸 Tweets are my own.
Mike Schumacher @schumacherama
2K Followers 507 Following Gut physiologist live-tweeting data on epithelial-immune dysfunction in the GI tract #organoids #ibd 🐾🍰✨🦋 https://t.co/DM7WGrgQki
Vijay Sankaran @bloodgenes
12K Followers 3K Following Pediatric Hematologist/Oncologist, Geneticist, Stem Cell Biologist - @HHMINEWS, @BostonChildrens, @DanaFarber, @broadinstitute
ludovic vallier @VallierLab
4K Followers 457 Following Liver biologist, human pluripotent stem cells, cell based therapy believer, opinions are my own.
Dr. Len Zon @leonard_zon
11K Followers 935 Following Director of the Stem Cell Program @BostonChildrens
Iannis Aifantis @iannisaifantis1
11K Followers 1K Following Cancer & Immunology Research. Professor & Chair, @NYUGSOM_Path @nyugrossman. All opinions are my own only. Visit me also on @instagram and @LinkedIn.
Stem Cell Network @StemCellNetwork
22K Followers 780 Following SCN is a Canadian not-for-profit supporting stem cell and regenerative medicine research, training, and knowledge mobilization.
Dr. Sara Nunes Vascon... @YYZscientist
3K Followers 2K Following Senior Scientist UHN. Associate Prof UofT. John Kiston McIvor Endowed Chair in Diabetes Research. https://t.co/8A5EmUtwNf
Don Ingber @DonIngber
7K Followers 220 Following Founding Director @wyssinstitute, Judah Folkman Prof. of Vascular Biology @bostonchildrens & @harvardmed, Hansjörg Wyss Prof. of Bioinspired Engineering @hseas
Stem Cell Podcast @stemcellpodcast
9K Followers 2K Following Join us as we discuss the latest stem cell research, policy, and news with field experts. Brought to you by @STEMCELLTech.
Rawlins Lab @LabRawlins
3K Followers 2K Following Rawlins Lab, Gurdon Institute, University of Cambridge #devbio
ESC & iPSC News @ESC_iPSC_News
8K Followers 780 Following An online resource for the pluripotent stem cell research community. Part of the @STEMCELLTech Science News service.
Kira Gritsman @Gritsman_lab
3K Followers 2K Following Physician-scientist investigating signaling and self-renewal in leukemia and hematopoietic stem cells. Posts are my own.
Faye Lewis @fayee_lewis
172 Followers 199 Following PhD Scholar researching Ovarian Cancer @ Trinity College Dublin/St. James’s Hospital 🧬👩🔬
Euan Adie @Stew
3K Followers 3K Following Ex-bioinformatician, ex-@nature, founded @altmetric, now @Overtonio (helping think tanks, NGOs and unis track policy impact). Nerdy. Also @mrstew.bsky.social
Grayson Rodriguez, Ph... @grayerodriguez
304 Followers 336 Following Proteins & signaling in the Red-Horse and Garcia Labs | @StanfordCVI T32 Fellow | @stanfordimmuno PhD | Formerly @parkerICI, @ChemistryMIT, & @kochinstitute
Jesse Dixon @Jesse_R_Dixon
1K Followers 140 Following Scientist | Assistant Professor at the Salk Institute for Biological Studies | M.D./Ph.D. from UC San Diego | Princeton Alum
Nozomu Takata 高田 ... @nozomu_takata
325 Followers 591 Following organoids, self-organization, biomaterials, regenerative medicine
Elizabeth Bradshaw @bradshaw2280
32 Followers 53 Following Neuroimmunologist studying human microglia and immunogenetics in neurodegenerative disorders
Ryan Hobson @RyanMHobson
71 Followers 83 Following Postdoctoral Scientist at Mass General/Harvard Medical School. Open to work in Boston, MA
Albert H. Kim @AlbertHKimMDPhD
3K Followers 970 Following Director, The Brain Tumor Center, @WashUBTC @WashUNeurosurg @WUSTLmed @BarnesJewish @SitemanCenter WashU Medicine
Wu Lab at UTHealth @LongJun_Wu
2K Followers 521 Following Neuroimmune interaction in health and disease @CNG_UTHealth @McGovernMed @UTHealthHouston
Aysegul Gungor Aydin @AGungorAydin
1K Followers 1K Following Assistant Professor @BRInjResearch | Auditory Neuroscientist studying auditory processing, neuroplasticity, neurodevelopment| Director@NEAF Lab
Dr. Melissa Sharpe @MelissaJSharpe
5K Followers 1K Following Neuroscience, Prefrontal Cortex, Dopamine, Lateral Hypothalamus, Reinforcement Learning, Wine. Senior Lecturer, USyd. Was an 🇦🇺 in 🇺🇸 (She/Her).
Chiosis Lab @chiosislabmskcc
289 Followers 444 Following 🔬🖥️🐭🇺🇸 The Gabriela Chiosis Lab in the Chemical Biology Program @MSKCancerCenter https://t.co/1ZSnOr70wB
Hwamee Oh @hwamee_oh
1K Followers 437 Following Associate Professor @BrownUniversity. Brain Imaging and Neuroscience of Visual Memory, Aging, and Alzheimer's disease. PI @OhLabBrown @hwameeoh.bsky.social
Priya Prakash @pryprk
3K Followers 889 Following Neuroscience postdoc @nyugrossman. Chemistry PhD @lifeatpurdue. Researching glial cell contributions to neurodegeneration. All opinions=mine only!
Rebekah Evans @cellularscale
2K Followers 1K Following Assistant Professor @Georgetown University Department of Neuroscience
Alcino J Silva @alcinojsilva
7K Followers 856 Following Neuroscientist working on memory and memory disorders, cartographer of science https://t.co/As2WJkJw5p, incidental musician and photographer
Michael Hasselmo @HasselmoMichael
3K Followers 321 Following Director of Center for Systems Neuroscience at Boston University @buCSNneuro Editor in Chief of the journal Hippocampus
Jiannis Taxidis @JiannisTax
1K Followers 847 Following SickKids Scientist (@SickKidsNews) & Asst Prof at Physiology, UofToronto @physiologyuoft. Hippocampus, learning, memory & beyond
Matthew D. Park, PhD @MatthewD_Park
614 Followers 257 Following M.D./Ph.D. candidate @SinaiMSTP in @MiriamMerad lab | Icahn School of Medicine at Mount Sinai | @ForbesUnder30 @Forbes
Ling Ling @SiuLingTai
305 Followers 669 Following PhD in Immunology @nkg2d1 lab @UofT | IBD, Cytokines, ILCs | Cook. Indoor gardener. Sustainability enthusiast | Opinions are my own @sltai.bsky.social
3Brain AG @3Brain
868 Followers 515 Following We build sophisticated #cell-electronic interfaces to probe intelligent biological networks by linking them to software. #Drugdiscovery
Sam Klempner @KlempnerSam
5K Followers 679 Following GI medical oncologist focusing on stomach and esophageal cancer research at Massachusetts General Hospital, Harvard Medical School
Kohei shitara @KoheiShitara
3K Followers 369 Following Medical oncologist at National Cancer Center Hospital East, Japan #gicancers #gastriccancer #colorectalcancer
Sanjeev Ranade @SanjeevRanade
1K Followers 1K Following Assistant Professor @sbpdiscovery. @AdditionalVent Catalyst to Independence Fellow; Postdoc: @GladstoneInst, PhD: @scrippsresearch
Ramon Klein Geltink @rkleingeltink
419 Followers 315 Following Assistant Professor, Dept. Pathology and Laboratory Medicine, UBC / Investigator, BC Children’s Hospital Research Institute
creative @SCTcreative
1 Followers 0 Following
Pouria Fattahi @Pouria_Fattahi
45 Followers 146 Following Assistant Professor, @universityofga Ex: @penn_state, @MayoClinic, @Penn
10x Genomics @10xGenomics
29K Followers 668 Following Enabling researchers to answer biology’s hardest and most elusive questions with innovative #singlecell, #spatialbiology & #insitu technology
Jefferson Antonio Lei... @jeffantleite
268 Followers 674 Following Assistant Professor at the Department of Immunology IMPG/UFRJ 🇧🇷
Haeryfar Lab @HaeryfarLab
42 Followers 61 Following Your friendly neighbourhood immunology lab #bestMAITs Account run by graduate students of the Haeryfar Lab
Felix B. @beecher31009380
348 Followers 1K Following Always 1 decision away from a completely different life |I like philosophy, dancing, and science|🇩🇪|BSc |MSc.alumni RegBioMed @CRTDpress |ENTP|Views = my own
Dr. Despina Siolas, M... @DrDespina123
692 Followers 294 Following GI Oncologist & Physician-Scientist @WeillCornell | KRAS, ctDNA & tumor-immune interactions in GI cancers | NIH K08 | https://t.co/Dlrs7YhuMb
Lotus Lum @LotusLumphocyte
60 Followers 111 Following Yale Immunobiology PhD student. UC Berkeley '19. Studying tumor associated macrophages but also i like to climb
Madison (Maddi) Strin... @madisonstrine
999 Followers 2K Following YSM Science Fellow studying human early life T cell-epithelial crosstalk in the lab of @LizaKonnikova | @YaleIBIO @WilenLab PhD ‘23 | @gettysburg ‘18 | she/her
Lena Wirth @lena__wirth
97 Followers 254 Following @YaleiBio PhD student in the @BraunMDPhD Lab | Studying T cells in kidney cancer
Christian Roig-Laboy @RoigLaboy
57 Followers 74 Following Ph.D student at @CincyChildrens | @UPR_Oficial & @UVA_BIMS ex-alumni | Bacterial and Enteroid Model Fanatic | Views are my own | 🇵🇷🇻🇳
Kuchroo Lab @KuchrooLab
3K Followers 314 Following Lab of Prof. Vijay Kuchroo @GeneLayInst @BrighamWomens @HarvardMed @BroadInstitute. Posts by lab members unless signed by VKK. Views are our own.
Robin Orozco (she/her... @Robswillenbring
446 Followers 340 Following 👩🔬 Assistant Professor @KUmolbio | Genetic variation impact on anti-viral immunity 🧬🦠 |former @scrippsresearch postdoc, @mayoclinic grad student
Aleksandra Mazitova @aleks_mazik
40 Followers 149 Following PhD candidate, RA III at @KatyaKoltsova lab, Cedars-Sinai Medical Center
Hai Huang @hansonhuangsums
197 Followers 175 Following Associate Professor, Feinstein Institutes for Medical Research. #Liver #Feinsteininstitute
Meihong Deng @MeihongDeng
160 Followers 146 Following
Jen Anolik @jenanolikMD
498 Followers 537 Following Professor of Medicine University of Rochester Medical Center; B cell autoimmunity lab- post-doc positions open
Ben @_benogorman
114 Followers 183 Following Doctoral student/researcher in the Dunleavy Lab investigating #epigenetic #centromere dynamics in the male #germline using #drosophila and #bovine models.
Indspire @Indspire
15K Followers 3K Following Indigenous registered charity that invests in the education of Indigenous people. This page is monitored Monday to Friday, 9:00 a.m. to 5:00 p.m./ EST
Mass General Brigham ... @MGBResearchNews
11K Followers 3K Following Where #science and #medicine converge to improve patient care at @MassGenBrigham We ❤️🔬
Gillies McIndoe Resea... @Gillies_McIndoe
70 Followers 171 Following A small biomedical research charity developing accessible treatments by repurposing medications and using spheroids/organoids. Your support matters!
Sean Escopete @Sean_Escopete
26 Followers 79 Following PhD Student @CedarsSinai in the @ArunSharmaPhD Lab | 🧫🫀🚀 | @CIRMNews Scholar 2025 | @CSUSBCNS Alumnus |🏳️🌈🇵🇭You might like
